Review



pgadt7 ad brca1  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    TaKaRa pgadt7 ad brca1
    Pgadt7 Ad Brca1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 3966 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgadt7+ad+brca1/pGADT7+AD+Vector/pm40275348-120-109-122
    Average 99 stars, based on 3966 article reviews
    pgadt7 ad brca1 - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer.
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [29]) using the primers Fw_Y2H_BARD1_NdeI (5’ G G A A T T C C A T A T G A T G G A T T T A T C T G C T C T T C G C G T T G) and Rv_BRCA1_SmaI (5’ T C C C C C G G G T C A G T A G T G G C T), and cloned into the SmaI-NdeI sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [30]) using the primers Fw_ Y2H_BARD1_SmaI (5’ T C C C C C G G G T A T G C C G G A T A A T C G G C A G C) and Rv_BARD1_Notl (5’ A T A A G A A T G C G G C C G C A T C A G C T G T C A A G A G G A A G C) and cloned into the SmaI-NotI sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [ ]) using the primers Fw_Y2H_BARD1_NdeI (5’ GGAATTCCATATGATGGATTTATCTGCTCTTCGCGTTG) and Rv_BRCA1_SmaI (5’ TCCCCCGGGTCAGTAGTGGCT), and cloned into the Sma I- Nde I sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Polymerase Chain Reaction:

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer.
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [29]) using the primers Fw_Y2H_BARD1_NdeI (5’ G G A A T T C C A T A T G A T G G A T T T A T C T G C T C T T C G C G T T G) and Rv_BRCA1_SmaI (5’ T C C C C C G G G T C A G T A G T G G C T), and cloned into the SmaI-NdeI sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [30]) using the primers Fw_ Y2H_BARD1_SmaI (5’ T C C C C C G G G T A T G C C G G A T A A T C G G C A G C) and Rv_BARD1_Notl (5’ A T A A G A A T G C G G C C G C A T C A G C T G T C A A G A G G A A G C) and cloned into the SmaI-NotI sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [ ]) using the primers Fw_Y2H_BARD1_NdeI (5’ GGAATTCCATATGATGGATTTATCTGCTCTTCGCGTTG) and Rv_BRCA1_SmaI (5’ TCCCCCGGGTCAGTAGTGGCT), and cloned into the Sma I- Nde I sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Plasmid Preparation:

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer.
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [29]) using the primers Fw_Y2H_BARD1_NdeI (5’ G G A A T T C C A T A T G A T G G A T T T A T C T G C T C T T C G C G T T G) and Rv_BRCA1_SmaI (5’ T C C C C C G G G T C A G T A G T G G C T), and cloned into the SmaI-NdeI sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [30]) using the primers Fw_ Y2H_BARD1_SmaI (5’ T C C C C C G G G T A T G C C G G A T A A T C G G C A G C) and Rv_BARD1_Notl (5’ A T A A G A A T G C G G C C G C A T C A G C T G T C A A G A G G A A G C) and cloned into the SmaI-NotI sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [ ]) using the primers Fw_Y2H_BARD1_NdeI (5’ GGAATTCCATATGATGGATTTATCTGCTCTTCGCGTTG) and Rv_BRCA1_SmaI (5’ TCCCCCGGGTCAGTAGTGGCT), and cloned into the Sma I- Nde I sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Clone Assay:

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer.
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [29]) using the primers Fw_Y2H_BARD1_NdeI (5’ G G A A T T C C A T A T G A T G G A T T T A T C T G C T C T T C G C G T T G) and Rv_BRCA1_SmaI (5’ T C C C C C G G G T C A G T A G T G G C T), and cloned into the SmaI-NdeI sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [30]) using the primers Fw_ Y2H_BARD1_SmaI (5’ T C C C C C G G G T A T G C C G G A T A A T C G G C A G C) and Rv_BARD1_Notl (5’ A T A A G A A T G C G G C C G C A T C A G C T G T C A A G A G G A A G C) and cloned into the SmaI-NotI sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [ ]) using the primers Fw_Y2H_BARD1_NdeI (5’ GGAATTCCATATGATGGATTTATCTGCTCTTCGCGTTG) and Rv_BRCA1_SmaI (5’ TCCCCCGGGTCAGTAGTGGCT), and cloned into the Sma I- Nde I sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Transformation Assay:

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer.
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [29]) using the primers Fw_Y2H_BARD1_NdeI (5’ G G A A T T C C A T A T G A T G G A T T T A T C T G C T C T T C G C G T T G) and Rv_BRCA1_SmaI (5’ T C C C C C G G G T C A G T A G T G G C T), and cloned into the SmaI-NdeI sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [30]) using the primers Fw_ Y2H_BARD1_SmaI (5’ T C C C C C G G G T A T G C C G G A T A A T C G G C A G C) and Rv_BARD1_Notl (5’ A T A A G A A T G C G G C C G C A T C A G C T G T C A A G A G G A A G C) and cloned into the SmaI-NotI sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.

    Article Title: A first-in-class inhibitor of homologous recombination DNA repair counteracts tumour growth, metastasis and therapeutic resistance in pancreatic cancer
    Article Snippet: The full-length wt human BRCA1 gene was amplified by polymerase chain reaction (PCR) from the plasmid GAL::BRCA1 YEp24 (kind gift from Craig B. Bennett [ ]) using the primers Fw_Y2H_BARD1_NdeI (5’ GGAATTCCATATGATGGATTTATCTGCTCTTCGCGTTG) and Rv_BRCA1_SmaI (5’ TCCCCCGGGTCAGTAGTGGCT), and cloned into the Sma I- Nde I sites of the pGADT7 AD prey vector (Takara Bio, Enzifarma, Porto, Portugal). .. The full-length BARD1 gene was amplified by PCR from the plasmid pY3H-AdeI-BARD1 (kind gift from Joanna R. Morris [ ]) using the primers Fw_Y2H_BARD1_SmaI (5’ TCCCCCGGGTATGCCGGATAATCGGCAGC) and Rv_BARD1_Notl (5’ ATAAGAATGCGGCCGCATCAGCTGTCAAGAGGAAGC) and cloned into the Sma I- Not I sites of the pGBKT7 bait vector (Takara Bio, Enzifarma, Porto, Portugal). pGADT7 AD-BRCA1, empty pGADT7 AD and pGADT7-T were transformed into Saccharomyces cerevisiae Y187 (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. pGBKT7-BARD1 and pGBKT7-53 were transformed into S. cerevisiae Y2H Gold (Takara Bio, Enzifarma, Porto, Portugal) and selected in SD/-Leu plates. .. Following the Matchmaker Gold Yeast Two-Hybrid System User Manual (Takara Bio, Enzifarma, Porto, Portugal), the BARD1 expressing strain was mated with the BRCA1 expressing strain (or strain transformed with the empty pGADT7 AD, to discard bait autoactivation and toxicity) and the diploids were selected on SD/-Trp/-Leu double drop out plates at 30 oC.



    Similar Products

    pgadt7 ad brca1  (TaKaRa)
    99
    TaKaRa pgadt7 ad brca1
    Pgadt7 Ad Brca1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgadt7+ad+brca1/pGADT7+AD+Vector/pm40275348-120-109-122
    Average 99 stars, based on 1 article reviews
    pgadt7 ad brca1 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results